Antibodies
Anti-NF2 Antibody-Oligo Conjugate
SKU: aoc2867
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NF2 Antibody-IF1
Antibody Target
- Target
- Merlin
- UniProt Number
- P35240
- Target Description
- Probable regulator of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway, a signaling pathway that plays a pivotal role in tumor suppression by restricting proliferation and promoting apoptosis. Along with WWC1 can synergistically induce the phosphorylation of LATS1 and LATS2 and can probably function in the regulation of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway. May act as a membrane stabilizing protein. May inhibit PI3 kinase by binding to AGAP2 and impairing its stimulating activity. Suppresses cell proliferation and tumorigenesis by inhibiting the CUL4A-RBX1-DDB1-VprBP/DCAF1 E3 ubiquitin-protein ligase complex.
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59903
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat