Antibodies
Anti-NG2 Antibody-Oligo Conjugate
SKU: aoc2877
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NG2 Antibody-IF1
Antibody Target
- Target
- Chondroitin sulfate proteoglycan 4
- UniProt Number
- Q6UVK1
- Target Description
- Proteoglycan playing a role in cell proliferation and migration which stimulates endothelial cells motility during microvascular morphogenesis. May also inhibit neurite outgrowth and growth cone collapse during axon regeneration. Cell surface receptor for collagen alpha 2(VI) which may confer cells ability to migrate on that substrate. Binds through its extracellular N-terminus growth factors, extracellular matrix proteases modulating their activity. May regulate MPP16-dependent degradation and invasion of type I collagen participating in melanoma cells invasion properties. May modulate the plasminogen system by enhancing plasminogen activation and inhibiting angiostatin. Also functions as a signal transducing protein by binding through its cytoplasmic C-terminus scaffolding and signaling proteins. May promote retraction fiber formation and cell polarization through Rho GTPase activation. May stimulate alpha-4, beta-1 integrin-mediated adhesion and spreading by recruiting and activating a signaling cascade through CDC42, ACK1 and BCAR1. May activate FAK and ERK1/ERK2 signaling cascades.
- Molecular Weight
- 251kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCFlow CytometryELISA
- Clone
- ARC64580
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse