Antibodies
Anti-NGLY1 Antibody-Oligo Conjugate
SKU: aoc2879
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NGLY1 Antibody-IF1
Antibody Target
- Target
- Peptide-N
- UniProt Number
- Q96IV0
- Target Description
- Specifically deglycosylates the denatured form of N-linked glycoproteins in the cytoplasm and assists their proteasome-mediated degradation. Cleaves the beta-aspartyl-glucosamine (GlcNAc) of the glycan and the amide side chain of Asn, converting Asn to Asp. Prefers proteins containing high-mannose over those bearing complex type oligosaccharides. Can recognize misfolded proteins in the endoplasmic reticulum that are exported to the cytosol to be destroyed and deglycosylate them, while it has no activity toward native proteins. Deglycosylation is a prerequisite for subsequent proteasome-mediated degradation of some, but not all, misfolded glycoproteins.
- Molecular Weight
- 74kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC59085
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat