Antibodies
Anti-NHLRC1 Antibody-Oligo Conjugate
SKU: aoc2882
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NHLRC1 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase NHLRC1
- UniProt Number
- Q6VVB1
- Target Description
- E3 ubiquitin-protein ligase. Together with the phosphatase EPM2A/laforin, appears to be involved in the clearance of toxic polyglucosan and protein aggregates via multiple pathways. In complex with EPM2A/laforin and HSP70, suppresses the cellular toxicity of misfolded proteins by promoting their degradation through the ubiquitin-proteasome system (UPS). Ubiquitinates the glycogen-targeting protein phosphatase subunits PPP1R3C/PTG and PPP1R3D in a laforin-dependent manner and targets them for proteasome-dependent degradation, thus decreasing glycogen accumulation. Polyubiquitinates EPM2A/laforin and ubiquitinates AGL and targets them for proteasome-dependent degradation. Also promotes proteasome-independent protein degradation through the macroautophagy pathway.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC68981
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human