Antibodies
Anti-NKp30 Antibody-Oligo Conjugate
SKU: aoc2884
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NKp30 Antibody-IF1
Antibody Target
- Target
- Natural cytotoxicity triggering receptor 3
- UniProt Number
- O14931
- Target Description
- Cell membrane receptor of natural killer/NK cells that is activated by binding of extracellular ligands including BAG6 and NCR3LG1. Stimulates NK cells cytotoxicity toward neighboring cells producing these ligands. It controls, for instance, NK cells cytotoxicity against tumor cells. Engagement of NCR3 by BAG6 also promotes myeloid dendritic cells (DC) maturation, both through killing DCs that did not acquire a mature phenotype, and inducing the release by NK cells of TNFA and IFNG which promote DC maturation.
- Molecular Weight
- 16kDa/17kDa/18kDa/19kDa/20kDa/21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFC (intra)ELISA
- Clone
- ARC60018
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human