Antibodies
Anti-NKX3.1 Antibody-Oligo Conjugate (ARC58355)
SKU: aoc2886
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NKX3.1 Antibody (ARC58355)-IF1
Antibody Target
- Target
- Homeobox protein Nkx-3.1
- UniProt Number
- Q99801
- Target Description
- Transcription factor, which binds preferentially the consensus sequence 5'-TAAGT[AG]-3' and can behave as a transcriptional repressor. Plays an important role in normal prostate development, regulating proliferation of glandular epithelium and in the formation of ducts in prostate. Acts as a tumor suppressor controlling prostate carcinogenesis, as shown by the ability to inhibit proliferation and invasion activities of PC-3 prostate cancer cells.
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58355
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat