AntibodiesNeuroMab
Anti-NMDAR1 Antibody-Oligo Conjugate
SKU: aoc26
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NMDAR1 Antibody-IF1
Antibody Target
- Target
- NMDAR1
- UniProt Number
- Q05586
- Target Description
- Glutamate receptor 1, NMDA 1, or GluN1/NR1 also known as subunit 1 of the N-methyl-D-aspartate (NMDA) receptor. It is a member of the glutamate receptor channel superfamily and is a heteromeric glutamate-gated calcium ion channel. GluN1 is essential for synaptic function in the brain. GluN1 is expressed throughout the brain in cerebellum, thalamus, olfactory bulb and cortex in the membrane at postsynaptic density. GluN1 plays a key role in synaptogenesis, synaptic plasticity, memory acquisition and learning. Mutations in the GluN1 gene are associated with intellectual disability and cortical visual impairment and movement disorders.
- Molecular Weight
- 105 kDa
- Synonyms
- Glutamate receptor ionotropic, NMDA 1 (GluN1) (Glutamate [NMDA] receptor subunit zeta-1) (N-methyl-D-aspartate receptor subunit NR1) (NMD-R1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- N308/48
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 42-361 (extracellular N-terminus) of rat NR1 (accession number P35439) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat