Antibodies
Anti-NMI Antibody-Oligo Conjugate
SKU: aoc2894
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NMI Antibody-IF1
Antibody Target
- Target
- N-myc-interactor
- UniProt Number
- Q13287
- Target Description
- Acts as a signaling pathway regulator involved in innate immune system response. In response to interleukin 2/IL2 and interferon IFN-gamma/IFNG, interacts with signal transducer and activator of transcription/STAT which activate the transcription of downstream genes involved in a multitude of signals for development and homeostasis. Enhances the recruitment of CBP/p300 coactivators to STAT1 and STAT5, resulting in increased STAT1- and STAT5-dependent transcription. In response to interferon IFN-alpha, associates in a complex with signaling pathway regulator IFI35 to regulate immune response; the complex formation prevents proteasome-mediated degradation of IFI35. In complex with IFI35, inhibits virus-triggered type I IFN-beta production when ubiquitinated by ubiquitin-protein ligase TRIM21. In complex with IFI35, negatively regulates nuclear factor NF-kappa-B signaling by inhibiting the nuclear translocation, activation and transcription of NF-kappa-B subunit p65/RELA, resulting in the inhibition of endothelial cell proliferation, migration and re-endothelialization of injured arteries. Negatively regulates virus-triggered type I interferon/IFN production by inducing proteosome-dependent degradation of IRF7, a transcriptional regulator of type I IFN, thereby interfering with cellular antiviral responses. Beside its role as an intracellular signaling pathway regulator, also functions extracellularly as damage-associated molecular patterns (DAMPs) to promote inflammation, when actively released by macrophage to the extracellular space during cell injury or pathogen invasion. Macrophage-secreted NMI activates NF-kappa-B signaling in adjacent macrophages through Toll-like receptor 4/TLR4 binding and activation, thereby inducing NF-kappa-B translocation from the cytoplasm into the nucleus which promotes the release of pro-inflammatory cytokines.
- Molecular Weight
- 35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3069
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant fusion protein containing a sequence corresponding to amino acids 1-100 of human NMI (NP_004679.2).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human