Antibodies
Anti-NNMT Antibody-Oligo Conjugate (ARC65463)
SKU: aoc2895
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NNMT Antibody (ARC65463)-IF1
Antibody Target
- Target
- Nicotinamide N-methyltransferase
- UniProt Number
- P40261
- Target Description
- Catalyzes the N-methylation of nicotinamide using the universal methyl donor S-adenosyl-L-methionine to form N1-methylnicotinamide and S-adenosyl-L-homocysteine, a predominant nicotinamide/vitamin B3 clearance pathway. Plays a central role in regulating cellular methylation potential, by consuming S-adenosyl-L-methionine and limiting its availability for other methyltransferases. Actively mediates genome-wide epigenetic and transcriptional changes through hypomethylation of repressive chromatin marks, such as H3K27me3. In a developmental context, contributes to low levels of the repressive histone marks that characterize pluripotent embryonic stem cell pre-implantation state. Acts as a metabolic regulator primarily on white adipose tissue energy expenditure as well as hepatic gluconeogenesis and cholesterol biosynthesis. In white adipocytes, regulates polyamine flux by consuming S-adenosyl-L-methionine which provides for propylamine group in polyamine biosynthesis, whereas by consuming nicotinamide controls NAD(+) levels through the salvage pathway. Via its product N1-methylnicotinamide regulates protein acetylation in hepatocytes, by repressing the ubiquitination and increasing the stability of SIRT1 deacetylase. Can also N-methylate other pyridines structurally related to nicotinamide and play a role in xenobiotic detoxification.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC65463
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human