Antibodies
Anti-Nogo Antibody-Oligo Conjugate
SKU: aoc2898
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Nogo Antibody-IF1
Antibody Target
- Target
- Reticulon-4
- UniProt Number
- Q9NQC3
- Target Description
- Required to induce the formation and stabilization of endoplasmic reticulum (ER) tubules. They regulate membrane morphogenesis in the ER by promoting tubular ER production. They influence nuclear envelope expansion, nuclear pore complex formation and proper localization of inner nuclear membrane proteins. However each isoform have specific functions mainly depending on their tissue expression specificities (Probable).; FUNCTION: [Isoform A]: Developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Regulates neurite fasciculation, branching and extension in the developing nervous system. Involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. Regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Acts as a negative regulator of central nervous system angiogenesis. Inhibits spreading, migration and sprouting of primary brain microvascular endothelial cells (MVECs). Also induces the retraction of MVECs lamellipodia and filopodia in a ROCK pathway-dependent manner.; FUNCTION: [Isoform B]: Mainly function in endothelial cells and vascular smooth muscle cells, is also involved in immune system regulation (Probable). Modulator of vascular remodeling, promotes the migration of endothelial cells but inhibits the migration of vascular smooth muscle cells. Regulates endothelial sphingolipid biosynthesis with direct effects on vascular function and blood pressure. Inhibits serine palmitoyltransferase, SPTLC1, the rate-limiting enzyme of the novo sphingolipid biosynthetic pathway, thereby controlling production of endothelial sphingosine-1-phosphate (S1P). Required to promote macrophage homing and functions such as cytokine/chemokine gene expression involved in angiogenesis, arteriogenesis and tissue repair. Mediates ICAM1 induced transendothelial migration of leukocytes such as monocytes and neutrophils and acute inflammation. Necessary for immune responses triggered by nucleic acid sensing TLRs, such as TLR9, is required for proper TLR9 location to endolysosomes. Also involved in immune response to LPS. Plays a role in liver regeneration through the modulation of hepatocytes proliferation. Reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. With isoform C, inhibits BACE1 activity and amyloid precursor protein processing.; FUNCTION: [Isoform C]: Regulates cardiomyocyte apoptosis upon hypoxic conditions. With isoform B, inhibits BACE1 activity and amyloid precursor protein processing.
- Molecular Weight
- 130kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1910
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat