Antibodies
Anti-NONO Antibody-Oligo Conjugate
SKU: aoc2901
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NONO Antibody-IF1
Antibody Target
- Target
- Non-POU domain-containing octamer-binding protein
- UniProt Number
- Q15233
- Target Description
- DNA- and RNA binding protein, involved in several nuclear processes. Binds the conventional octamer sequence in double-stranded DNA. Also binds single-stranded DNA and RNA at a site independent of the duplex site. Involved in pre-mRNA splicing, probably as a heterodimer with SFPQ. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. Together with PSPC1, required for the formation of nuclear paraspeckles. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1. The SFPQ-NONO heteromer may be involved in DNA non-homologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends. In vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. NONO is involved in transcriptional regulation. The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional activity. NONO binds to an enhancer element in long terminal repeats of endogenous intracisternal A particles (IAPs) and activates transcription. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-BMAL1 heterodimer. Important for the functional organization of GABAergic synapses. Plays a specific and important role in the regulation of synaptic RNAs and GPHN/gephyrin scaffold structure, through the regulation of GABRA2 transcript. Plays a key role during neuronal differentiation by recruiting TET1 to genomic loci and thereby regulating 5-hydroxymethylcytosine levels. Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway. Promotes activation of the cGAS-STING pathway in response to HIV-2 infection: acts by interacting with HIV-2 Capsid protein p24, thereby promoting detection of viral DNA by CGAS, leading to CGAS-mediated inmmune activation. In contrast, the weak interaction with HIV-1 Capsid protein p24 does not allow activation of the cGAS-STING pathway.
- Molecular Weight
- 54 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0836
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat