Antibodies
Anti-Notch1 Antibody-Oligo Conjugate
SKU: aoc2905
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Notch1 Antibody-PLA1
Antibody Target
- Target
- Neurogenic locus notch homolog protein 1
- UniProt Number
- P46531
- Target Description
- Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. May enhance HIF1A function by sequestering HIF1AN away from HIF1A. Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO).
- Molecular Weight
- 273kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0285
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse