Antibodies
Anti-NOX4 Antibody-Oligo Conjugate
SKU: aoc2907
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NOX4 Antibody-IF1
Antibody Target
- Target
- NADPH oxidase 4
- UniProt Number
- Q9NPH5
- Target Description
- NADPH oxidase that catalyzes predominantly the reduction of oxygen to H2O2. Can also catalyze to a smaller extent, the reduction of oxygen to superoxide. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB. May produce superoxide in the nucleus and play a role in regulating gene expression upon cell stimulation. Promotes ferroptosis, reactive oxygen species production and reduced glutathione (GSH) levels by activating NLRP3 inflammasome activation and cytokine release.; FUNCTION: [Isoform 4]: NADPH oxidase that catalyzes the generation of superoxide from molecular oxygen utilizing NADPH as an electron donor. Involved in redox signaling in vascular cells. Modulates the nuclear activation of ERK1/2 and the ELK1 transcription factor, and is capable of inducing nuclear DNA damage.; FUNCTION: [Isoform 3]: Lacks superoxide-generating NADPH oxidase activity.
- Molecular Weight
- 67KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55045
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human