Antibodies
Anti-NPC1 Antibody-Oligo Conjugate
SKU: aoc2908
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NPC1 Antibody-IF1
Antibody Target
- Target
- NPC intracellular cholesterol transporter 1
- UniProt Number
- O15118
- Target Description
- Intracellular cholesterol transporter which acts in concert with NPC2 and plays an important role in the egress of cholesterol from the endosomal/lysosomal compartment. Unesterified cholesterol that has been released from LDLs in the lumen of the late endosomes/lysosomes is transferred by NPC2 to the cholesterol-binding pocket in the N-terminal domain of NPC1. Cholesterol binds to NPC1 with the hydroxyl group buried in the binding pocket. Binds oxysterol with higher affinity than cholesterol. May play a role in vesicular trafficking in glia, a process that may be crucial for maintaining the structural and functional integrity of nerve terminals (Probable). Inhibits cholesterol-mediated mTORC1 activation throught its interaction with SLC38A9.; FUNCTION: (Microbial infection) Acts as an endosomal entry receptor for ebolavirus.
- Molecular Weight
- 142 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2713
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat