Antibodies
Anti-NPC2 Antibody-Oligo Conjugate
SKU: aoc2909
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NPC2 Antibody-IF1
Antibody Target
- Target
- NPC intracellular cholesterol transporter 2
- UniProt Number
- P61916
- Target Description
- Intracellular cholesterol transporter which acts in concert with NPC1 and plays an important role in the egress of cholesterol from the lysosomal compartment. Unesterified cholesterol that has been released from LDLs in the lumen of the late endosomes/lysosomes is transferred by NPC2 to the cholesterol-binding pocket in the N-terminal domain of NPC1. May bind and mobilize cholesterol that is associated with membranes. NPC2 binds cholesterol with a 1:1 stoichiometry. Can bind a variety of sterols, including lathosterol, desmosterol and the plant sterols stigmasterol and beta-sitosterol. The secreted form of NCP2 regulates biliary cholesterol secretion via stimulation of ABCG5/ABCG8-mediated cholesterol transport.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC59098
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat