Antibodies
Anti-NPM1 Antibody-Oligo Conjugate
SKU: aoc2912
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NPM1 Antibody-IF1
Antibody Target
- Target
- Nucleophosmin
- UniProt Number
- P06748
- Target Description
- Involved in diverse cellular processes such as ribosome biogenesis, centrosome duplication, protein chaperoning, histone assembly, cell proliferation, and regulation of tumor suppressors p53/TP53 and ARF. Binds ribosome presumably to drive ribosome nuclear export. Associated with nucleolar ribonucleoprotein structures and bind single-stranded nucleic acids. Acts as a chaperonin for the core histones H3, H2B and H4. Stimulates APEX1 endonuclease activity on apurinic/apyrimidinic (AP) double-stranded DNA but inhibits APEX1 endonuclease activity on AP single-stranded RNA. May exert a control of APEX1 endonuclease activity within nucleoli devoted to repair AP on rDNA and the removal of oxidized rRNA molecules. In concert with BRCA2, regulates centrosome duplication. Regulates centriole duplication: phosphorylation by PLK2 is able to trigger centriole replication. Negatively regulates the activation of EIF2AK2/PKR and suppresses apoptosis through inhibition of EIF2AK2/PKR autophosphorylation. Antagonizes the inhibitory effect of ATF5 on cell proliferation and relieves ATF5-induced G2/M blockade. In complex with MYC enhances the transcription of MYC target genes. May act as chaperonin or cotransporter in the nucleolar localization of transcription termination factor TTF1.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC73080
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat