Antibodies
Anti-NQO1 Antibody-Oligo Conjugate
SKU: aoc2915
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NQO1 Antibody-IF1
Antibody Target
- Target
- NAD
- UniProt Number
- P15559
- Target Description
- Flavin-containing quinone reductase that catalyzes two-electron reduction of quinones to hydroquinones using either NADH or NADPH as electron donors. In a ping-pong kinetic mechanism, the electrons are sequentially transferred from NAD(P)H to flavin cofactor and then from reduced flavin to the quinone, bypassing the formation of semiquinone and reactive oxygen species. Regulates cellular redox state primarily through quinone detoxification. Reduces components of plasma membrane redox system such as coenzyme Q and vitamin quinones, producing antioxidant hydroquinone forms. In the process may function as superoxide scavenger to prevent hydroquinone oxidation and facilitate excretion. Alternatively, can activate quinones and their derivatives by generating redox reactive hydroquinones with DNA cross-linking antitumor potential. Acts as a gatekeeper of the core 20S proteasome known to degrade proteins with unstructured regions. Upon oxidative stress, interacts with tumor suppressors TP53 and TP73 in a NADH-dependent way and inhibits their ubiquitin-independent degradation by the 20S proteasome.
- Molecular Weight
- 31 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC56754
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat