Antibodies
Anti-NRF1 Antibody-Oligo Conjugate
SKU: aoc2921
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NRF1 Antibody-IF1
Antibody Target
- Target
- Nuclear respiratory factor 1
- UniProt Number
- Q16656
- Target Description
- Transcription factor that activates the expression of the EIF2S1 (EIF2-alpha) gene. Links the transcriptional modulation of key metabolic genes to cellular growth and development. Implicated in the control of nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication.
- Molecular Weight
- 54 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISAChIPCUT&Tag
- Clone
- ARC0768
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat