Antibodies
Anti-NSUN2 Antibody-Oligo Conjugate
SKU: aoc2926
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NSUN2 Antibody-IF1
Antibody Target
- Target
- RNA cytosine C
- UniProt Number
- Q08J23
- Target Description
- RNA cytosine C(5)-methyltransferase that methylates cytosine to 5-methylcytosine (m5C) in various RNAs, such as tRNAs, mRNAs and some long non-coding RNAs (lncRNAs). Involved in various processes, such as epidermal stem cell differentiation, testis differentiation and maternal to zygotic transition during early development: acts by increasing protein synthesis; cytosine C(5)-methylation promoting tRNA stability and preventing mRNA decay. Methylates cytosine to 5-methylcytosine (m5C) at positions 34 and 48 of intron-containing tRNA(Leu)(CAA) precursors, and at positions 48, 49 and 50 of tRNA(Gly)(GCC) precursors. tRNA methylation is required generation of RNA fragments derived from tRNAs (tRFs). Also mediates C(5)-methylation of mitochondrial tRNAs. Catalyzes cytosine C(5)-methylation of mRNAs, leading to stabilize them and prevent mRNA decay: mRNA stabilization involves YBX1 that specifically recognizes and binds m5C-modified transcripts. Cytosine C(5)-methylation of mRNAs also regulates mRNA export: methylated transcripts are specifically recognized by THOC4/ALYREF, which mediates mRNA nucleo-cytoplasmic shuttling. Also mediates cytosine C(5)-methylation of non-coding RNAs, such as vault RNAs (vtRNAs), promoting their processing into regulatory small RNAs. Cytosine C(5)-methylation of vtRNA VTRNA1.1 promotes its processing into small-vault RNA4 (svRNA4) and regulates epidermal differentiation. May act downstream of Myc to regulate epidermal cell growth and proliferation. Required for proper spindle assembly and chromosome segregation, independently of its methyltransferase activity.
- Molecular Weight
- 86 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC65426
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse