Antibodies
Anti-Nuclear Matrix Protein p84 Antibody-Oligo Conjugate
SKU: aoc2928
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Nuclear Matrix Protein p84 Antibody-PLA1
Antibody Target
- Target
- THO complex subunit 1
- UniProt Number
- Q96FV9
- Target Description
- Component of the THO subcomplex of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and which specifically associates with spliced mRNA and not with unspliced pre-mRNA. Required for efficient export of polyadenylated RNA. The THOC1-THOC2-THOC3 core complex alone is sufficient to bind export factor NXF1-NXT1 and promote ATPase activity of DDX39B/UAP56. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NXF1 pathway. Regulates transcriptional elongation of a subset of genes. Involved in genome stability by preventing co-transcriptional R-loop formation. May play a role in hair cell formation, hence may be involved in hearing.; FUNCTION: Participates in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. This pathway does not require p53/TP53, nor does the presence of p53/TP53 affect the efficiency of cell killing. Activates a G2/M cell cycle checkpoint prior to the onset of apoptosis. Apoptosis is inhibited by association with RB1.; FUNCTION: (Microbial infection) The TREX complex is essential for the export of Kaposi's sarcoma-associated herpesvirus (KSHV) intronless mRNAs and infectious virus production.
- Molecular Weight
- 76kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1504
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat