Antibodies
Anti-Nucleolin Antibody-Oligo Conjugate
SKU: aoc2929
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Nucleolin Antibody-IF1
Antibody Target
- Target
- Nucleolin
- UniProt Number
- P19338
- Target Description
- Nucleolin is the major nucleolar protein of growing eukaryotic cells. It is found associated with intranucleolar chromatin and pre-ribosomal particles. It induces chromatin decondensation by binding to histone H1. It is thought to play a role in pre-rRNA transcription and ribosome assembly. May play a role in the process of transcriptional elongation. Binds RNA oligonucleotides with 5'-UUAGGG-3' repeats more tightly than the telomeric single-stranded DNA 5'-TTAGGG-3' repeats.
- Molecular Weight
- 77kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2879
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human