Antibodies
Anti-NUDT19 Antibody-Oligo Conjugate
SKU: aoc2931
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NUDT19 Antibody-IF1
Antibody Target
- Target
- Acyl-coenzyme A diphosphatase NUDT19
- UniProt Number
- A8MXV4
- Target Description
- Fatty acyl-coenzyme A (CoA) diphosphatase that hydrolyzes fatty acyl-CoA to yield acyl-4'-phosphopantetheine and adenosine 3',5'-bisphosphate. Mediates the hydrolysis of a wide range of CoA esters, including choloyl-CoA and branched-chain fatty-acyl-CoA esters and at low substrate concentrations medium and long-chain fatty-acyl-CoA esters are the primary substrates. Highest activity seen with medium-chain acyl-CoA esters and higher rates of activity seen with the unsaturated acyl-CoA esters compared with the saturated esters. Exhibits decapping activity towards dpCoA-capped RNAs in vitro.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2938
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat