Antibodies
Anti-NuMA Antibody-Oligo Conjugate
SKU: aoc2934
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NuMA Antibody-IF1
Antibody Target
- Target
- Nuclear mitotic apparatus protein 1
- UniProt Number
- Q14980
- Target Description
- Microtubule (MT)-binding protein that plays a role in the formation and maintenance of the spindle poles and the alignement and the segregation of chromosomes during mitotic cell division. Functions to tether the minus ends of MTs at the spindle poles, which is critical for the establishment and maintenance of the spindle poles. Plays a role in the establishment of the mitotic spindle orientation during metaphase and elongation during anaphase in a dynein-dynactin-dependent manner. In metaphase, part of a ternary complex composed of GPSM2 and G(i) alpha proteins, that regulates the recruitment and anchorage of the dynein-dynactin complex in the mitotic cell cortex regions situated above the two spindle poles, and hence regulates the correct oritentation of the mitotic spindle. During anaphase, mediates the recruitment and accumulation of the dynein-dynactin complex at the cell membrane of the polar cortical region through direct association with phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2), and hence participates in the regulation of the spindle elongation and chromosome segregation. Also binds to other polyanionic phosphoinositides, such as phosphatidylinositol 3-phosphate (PIP), lysophosphatidic acid (LPA) and phosphatidylinositol triphosphate (PIP3), in vitro. Also required for proper orientation of the mitotic spindle during asymmetric cell divisions. Plays a role in mitotic MT aster assembly. Involved in anastral spindle assembly. Positively regulates TNKS protein localization to spindle poles in mitosis. Highly abundant component of the nuclear matrix where it may serve a non-mitotic structural role, occupies the majority of the nuclear volume. Required for epidermal differentiation and hair follicle morphogenesis.
- Molecular Weight
- 238kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1000
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat