Antibodies
Anti-NUMB Antibody-Oligo Conjugate
SKU: aoc2935
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-NUMB Antibody-PLA1
Antibody Target
- Target
- Protein numb homolog
- UniProt Number
- P49757
- Target Description
- Regulates clathrin-mediated receptor endocytosis. Plays a role in the process of neurogenesis. Required throughout embryonic neurogenesis to maintain neural progenitor cells, also called radial glial cells (RGCs), by allowing their daughter cells to choose progenitor over neuronal cell fate. Not required for the proliferation of neural progenitor cells before the onset of neurogenesis. Also involved postnatally in the subventricular zone (SVZ) neurogenesis by regulating SVZ neuroblasts survival and ependymal wall integrity. May also mediate local repair of brain ventricular wall damage.
- Molecular Weight
- 71kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1390
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse