Antibodies
Anti-NUP153 Antibody-Oligo Conjugate
SKU: aoc2937
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NUP153 Antibody-IF1
Antibody Target
- Target
- Nuclear pore complex protein Nup153
- UniProt Number
- P49790
- Target Description
- Component of the nuclear pore complex (NPC), a complex required for the trafficking across the nuclear envelope. Functions as a scaffolding element in the nuclear phase of the NPC essential for normal nucleocytoplasmic transport of proteins and mRNAs. Involved in the quality control and retention of unspliced mRNAs in the nucleus; in association with TPR, regulates the nuclear export of unspliced mRNA species bearing constitutive transport element (CTE) in a NXF1- and KHDRBS1-independent manner. Mediates TPR anchoring to the nuclear membrane at NPC. The repeat-containing domain may be involved in anchoring other components of the NPC to the pore membrane. Possible DNA-binding subunit of the nuclear pore complex (NPC).; FUNCTION: (Microbial infection) Interacts with HIV-1 caspid protein P24 and thereby promotes the integration of the virus in the nucleus of non-dividing cells (in vitro).; FUNCTION: (Microbial infection) Binds HIV-2 protein vpx and thereby promotes the nuclear translocation of the lentiviral genome (in vitro).
- Molecular Weight
- 154kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1922
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat