Antibodies
Anti-NXF1 Antibody-Oligo Conjugate
SKU: aoc2942
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-NXF1 Antibody-PLA1
Antibody Target
- Target
- Nuclear RNA export factor 1
- UniProt Number
- Q9UBU9
- Target Description
- Involved in the nuclear export of mRNA species bearing retroviral constitutive transport elements (CTE) and in the export of mRNA from the nucleus to the cytoplasm (TAP/NFX1 pathway). The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5 components of the TREX complex. ALYREF/THOC4-bound mRNA is thought to be transferred to the NXF1-NXT1 heterodimer for export. Also involved in nuclear export of m6A-containing mRNAs: interaction between SRSF3 and YTHDC1 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1, promoting mRNA nuclear export.
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC2013
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human