Antibodies
Anti-OGDH Antibody-Oligo Conjugate
SKU: aoc2947
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-OGDH Antibody-IF1
Antibody Target
- Target
- 2-oxoglutarate dehydrogenase complex component E1
- UniProt Number
- Q02218
- Target Description
- 2-oxoglutarate dehydrogenase (E1o) component of the 2-oxoglutarate dehydrogenase complex (OGDHC). Participates in the first step, rate limiting for the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2) catalyzed by the whole OGDHC. Catalyzes the irreversible decarboxylation of 2-oxoglutarate (alpha-ketoglutarate) via the thiamine diphosphate (ThDP) cofactor and subsequent transfer of the decarboxylated acyl intermediate on an oxidized dihydrolipoyl group that is covalently amidated to the E2 enzyme (dihydrolipoyllysine-residue succinyltransferase or DLST). Plays a key role in the Krebs (citric acid) cycle, which is a common pathway for oxidation of fuel molecules, including carbohydrates, fatty acids, and amino acids. Can catalyze the decarboxylation of 2-oxoadipate in vitro, but at a much lower rate than 2-oxoglutarate. Mainly active in the mitochondrion. A fraction of the 2-oxoglutarate dehydrogenase complex also localizes in the nucleus and is required for lysine succinylation of histones: associates with KAT2A on chromatin and provides succinyl-CoA to histone succinyltransferase KAT2A.
- Molecular Weight
- 116 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC55379
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat