Antibodies

Anti-OGT Antibody-Oligo Conjugate

SKU: aoc2949

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-OGT Antibody-PLA1

Antibody Target

Target
UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110 kDa subunit
UniProt Number
O15294
Target Description
Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in cytoplasmic and nuclear proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Glycosylates a large and diverse number of proteins including histone H2B, AKT1, AMPK, ATG4B, CAPRIN1, EZH2, FNIP1, GSDMD, KRT7, LMNA, LMNB1, LMNB2, RPTOR, HOXA1, PFKL, KMT2E/MLL5, MAPT/TAU, TET2, RBL2, RET, NOD2 and HCFC1. Can regulate their cellular processes via cross-talk between glycosylation and phosphorylation or by affecting proteolytic processing. Involved in insulin resistance in muscle and adipocyte cells via glycosylating insulin signaling components and inhibiting the 'Thr-308' phosphorylation of AKT1, enhancing IRS1 phosphorylation and attenuating insulin signaling. Involved in glycolysis regulation by mediating glycosylation of 6-phosphofructokinase PFKL, inhibiting its activity. Plays a key role in chromatin structure by mediating O-GlcNAcylation of 'Ser-112' of histone H2B: recruited to CpG-rich transcription start sites of active genes via its interaction with TET proteins (TET1, TET2 or TET3). As part of the NSL complex indirectly involved in acetylation of nucleosomal histone H4 on several lysine residues. O-GlcNAcylation of 'Ser-75' of EZH2 increases its stability, and facilitating the formation of H3K27me3 by the PRC2/EED-EZH2 complex. Stabilizes KMT2E/MLL5 by mediating its glycosylation, thereby preventing KMT2E/MLL5 ubiquitination. Regulates circadian oscillation of the clock genes and glucose homeostasis in the liver. Stabilizes clock proteins BMAL1 and CLOCK through O-glycosylation, which prevents their ubiquitination and subsequent degradation. Promotes the CLOCK-BMAL1-mediated transcription of genes in the negative loop of the circadian clock such as PER1/2 and CRY1/2. O-glycosylates HCFC1 and regulates its proteolytic processing and transcriptional activity. Component of a THAP1/THAP3-HCFC1-OGT complex that is required for the regulation of the transcriptional activity of RRM1. Regulates mitochondrial motility in neurons by mediating glycosylation of TRAK1. Promotes autophagy by mediating O-glycosylation of ATG4B. Acts as a regulator of mTORC1 signaling by mediating O-glycosylation of RPTOR and FNIP1: O-GlcNAcylation of RPTOR in response to glucose sufficiency promotes activation of the mTORC1 complex.; FUNCTION: [Isoform 2]: The mitochondrial isoform (mOGT) is cytotoxic and triggers apoptosis in several cell types including INS1, an insulinoma cell line.; FUNCTION: [Isoform 4]: Has N-acetylglucosaminyltransferase activity: glycosylates proteins, such as HNRNPU, NEUROD1, NUP62 and PDCD6IP. Displays specific substrate selectivity compared to other isoforms.
Molecular Weight
117kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBELISAChIP
Clone
ARC0790
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat