Antibodies
Anti-Olig2 Antibody-Oligo Conjugate (ARC75695)
SKU: aoc2951
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Olig2 Antibody (ARC75695)-IF1
Antibody Target
- Target
- Oligodendrocyte transcription factor 2
- UniProt Number
- Q13516
- Target Description
- Required for oligodendrocyte and motor neuron specification in the spinal cord, as well as for the development of somatic motor neurons in the hindbrain. Functions together with ZNF488 to promote oligodendrocyte differentiation. Cooperates with OLIG1 to establish the pMN domain of the embryonic neural tube. Antagonist of V2 interneuron and of NKX2-2-induced V3 interneuron development.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC75695
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat