Antibodies
Anti-Oncostatin M Antibody-Oligo Conjugate
SKU: aoc2954
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Oncostatin M Antibody-IF1
Antibody Target
- Target
- Oncostatin-M
- UniProt Number
- P13725
- Target Description
- Growth regulator. Inhibits the proliferation of a number of tumor cell lines. Stimulates proliferation of AIDS-KS cells. It regulates cytokine production, including IL-6, G-CSF and GM-CSF from endothelial cells. Uses both type I OSM receptor (heterodimers composed of LIFR and IL6ST) and type II OSM receptor (heterodimers composed of OSMR and IL6ST). Involved in the maturation of fetal hepatocytes, thereby promoting liver development and regeneration.
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC1194
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat