Antibodies
Anti-ORM1/2 Antibody-Oligo Conjugate
SKU: aoc2957
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ORM1/2 Antibody-IF1
Antibody Target
- Target
- Alpha-1-acid glycoprotein 1
- Additional Target Information
- This antibody also binds Alpha-1-acid glycoprotein 2, Uniprot:P19652.
- UniProt Number
- P02763
- Target Description
- Functions as a transport protein in the blood stream. Binds various ligands in the interior of its beta-barrel domain. Also binds synthetic drugs and influences their distribution and availability in the body. Appears to function in modulating the activity of the immune system during the acute-phase reaction.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2263
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human