Antibodies
Anti-OXGR1 / GPR99 Antibody-Oligo Conjugate
SKU: aoc2964
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-OXGR1 / GPR99 Antibody-IF1
Antibody Target
- Target
- 2-oxoglutarate receptor 1
- UniProt Number
- Q96P68
- Target Description
- G protein-coupled receptor for dicarboxylates and amino dicarboxylates. Receptor for itaconate, a metabolite produced by myeloid lineages. In the respiratory epithelium, couples the binding of itaconate to the activation of GNA11 and downstream intracellular Ca(2+) release, leading to mucocilliary clearance of airborne pathogens. Receptor for leukotriene E4 (LTE4) produced by mast cells upon allergic inflammation. Binds with high affinity to LTE4 and elicits mucin release from pulmonary epithelium in response to airborne fungi allergens. Regulates mucin-producing goblet cell homeostasis. Receptor for alpha-ketoglutarate produced by proximal tubule renal cells upon metabolic alkalosis. In an intrarenal paracrine signaling pathway, binds alpha-ketoglutarate and drives transepithelial salt reabsorption and bicarbonate secretion by SLC26A4/pendrin-positive intercalated cells.
- Molecular Weight
- 38 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2892
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat