Antibodies
Anti-P Glycoprotein Antibody-Oligo Conjugate
SKU: aoc2967
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-P Glycoprotein Antibody-IF1
Antibody Target
- Target
- ATP-dependent translocase ABCB1
- UniProt Number
- P08183
- Target Description
- Translocates drugs and phospholipids across the membrane. Catalyzes the flop of phospholipids from the cytoplasmic to the exoplasmic leaflet of the apical membrane. Participates mainly to the flop of phosphatidylcholine, phosphatidylethanolamine, beta-D-glucosylceramides and sphingomyelins. Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
- Molecular Weight
- 141kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC73057
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat