Antibodies
Anti-P23/PTGES3 Antibody-Oligo Conjugate
SKU: aoc2969
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-P23/PTGES3 Antibody-IF1
Antibody Target
- Target
- Prostaglandin E synthase 3
- UniProt Number
- Q15185
- Target Description
- Cytosolic prostaglandin synthase that catalyzes the oxidoreduction of prostaglandin endoperoxide H2 (PGH2) to prostaglandin E2 (PGE2). Molecular chaperone that localizes to genomic response elements in a hormone-dependent manner and disrupts receptor-mediated transcriptional activation, by promoting disassembly of transcriptional regulatory complexes. Facilitates HIF alpha proteins hydroxylation via interaction with EGLN1/PHD2, leading to recruit EGLN1/PHD2 to the HSP90 pathway.
- Molecular Weight
- 19 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1986
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat