Antibodies
Anti-p27 Antibody-Oligo Conjugate
SKU: aoc2970
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-p27 Antibody-IF1
Antibody Target
- Target
- Cyclin-dependent kinase inhibitor 1B
- UniProt Number
- P46527
- Target Description
- Important regulator of cell cycle progression. Inhibits the kinase activity of CDK2 bound to cyclin A, but has little inhibitory activity on CDK2 bound to SPDYA. Involved in G1 arrest. Potent inhibitor of cyclin E- and cyclin A-CDK2 complexes. Forms a complex with cyclin type D-CDK4 complexes and is involved in the assembly, stability, and modulation of CCND1-CDK4 complex activation. Acts either as an inhibitor or an activator of cyclin type D-CDK4 complexes depending on its phosphorylation state and/or stoichometry.
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0455
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat