Antibodies
Anti-P2RX4 Antibody-Oligo Conjugate
SKU: aoc2972
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-P2RX4 Antibody-IF1
Antibody Target
- Target
- P2X purinoceptor 4
- UniProt Number
- Q99571
- Target Description
- ATP-gated nonselective transmembrane cation channel permeable to potassium, sodium and calcium. CTP, but not GTP or UTP, functions as a weak affinity agonist for P2RX4. Activated by extracellularly released ATP, it plays multiple role in immunity and central nervous system physiology. Plays a key role in initial steps of T-cell activation and Ca(2+) microdomain formation. Also participates in basal T-cell activity without TCR/CD3 stimulation. Promotes the differentiation and activation of Th17 cells via expression of retinoic acid-related orphan receptor C/RORC. Upon activation, drives microglia motility via the PI3K/Akt pathway. Could also function as an ATP-gated cation channel of lysosomal membranes.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat