Antibodies
Anti-p40-phox Antibody-Oligo Conjugate
SKU: aoc2978
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-p40-phox Antibody-IF1
Antibody Target
- Target
- Neutrophil cytosol factor 4
- UniProt Number
- Q15080
- Target Description
- Subunit of the phagocyte NADPH oxidase complex that mediates the transfer of electrons from cytosolic NADPH to O2 to produce the superoxide anion (O2(-)) (Probable). In the activated complex, electrons are first transferred from NADPH to flavin adenine dinucleotide (FAD) and subsequently transferred via two heme molecules to molecular oxygen, producing superoxide through an outer-sphere reaction. Activation of the NADPH oxidase complex is initiated by the assembly of cytosolic subunits of the NADPH oxidase complex with the core NADPH oxidase complex to form a complex at the plasma membrane or phagosomal membrane. This activation process is initiated by phosphorylation dependent binding of the cytosolic NCF1/p47-phox subunit to the C-terminus of CYBA/p22-phox.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC2553
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human