Antibodies
Anti-p53 DINP1 Antibody-Oligo Conjugate
SKU: aoc2983
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-p53 DINP1 Antibody-IF1
Antibody Target
- Target
- Tumor protein p53-inducible nuclear protein 1
- UniProt Number
- Q96A56
- Target Description
- Antiproliferative and proapoptotic protein involved in cell stress response which acts as a dual regulator of transcription and autophagy. Acts as a positive regulator of autophagy. In response to cellular stress or activation of autophagy, relocates to autophagosomes where it interacts with autophagosome-associated proteins GABARAP, GABARAPL1/L2, MAP1LC3A/B/C and regulates autophagy. Acts as an antioxidant and plays a major role in p53/TP53-driven oxidative stress response. Possesses both a p53/TP53-independent intracellular reactive oxygen species (ROS) regulatory function and a p53/TP53-dependent transcription regulatory function. Positively regulates p53/TP53 and p73/TP73 and stimulates their capacity to induce apoptosis and regulate cell cycle. In response to double-strand DNA breaks, promotes p53/TP53 phosphorylation on 'Ser-46' and subsequent apoptosis. Acts as a tumor suppressor by inducing cell death by an autophagy and caspase-dependent mechanism. Can reduce cell migration by regulating the expression of SPARC.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2102
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat