Antibodies
Anti-p63 Antibody-Oligo Conjugate
SKU: aoc2985
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-p63 Antibody-IF1
Antibody Target
- Target
- Tumor protein 63
- UniProt Number
- Q9H3D4
- Target Description
- Acts as a sequence specific DNA binding transcriptional activator or repressor. The isoforms contain a varying set of transactivation and auto-regulating transactivation inhibiting domains thus showing an isoform specific activity. Isoform 2 activates RIPK4 transcription. May be required in conjunction with TP73/p73 for initiation of p53/TP53 dependent apoptosis in response to genotoxic insults and the presence of activated oncogenes. Involved in Notch signaling by probably inducing JAG1 and JAG2. Plays a role in the regulation of epithelial morphogenesis. The ratio of DeltaN-type and TA*-type isoforms may govern the maintenance of epithelial stem cell compartments and regulate the initiation of epithelial stratification from the undifferentiated embryonal ectoderm. Required for limb formation from the apical ectodermal ridge. Activates transcription of the p21 promoter.
- Molecular Weight
- 45-77 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0131
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse