Antibodies
Anti-PABPN1 Antibody-Oligo Conjugate
SKU: aoc2991
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PABPN1 Antibody-IF1
Antibody Target
- Target
- Polyadenylate-binding protein 2
- UniProt Number
- Q86U42
- Target Description
- Involved in the 3'-end formation of mRNA precursors (pre-mRNA) by the addition of a poly(A) tail of 200-250 nt to the upstream cleavage product. Stimulates poly(A) polymerase (PAPOLA) conferring processivity on the poly(A) tail elongation reaction and also controls the poly(A) tail length. Increases the affinity of poly(A) polymerase for RNA. Is also present at various stages of mRNA metabolism including nucleocytoplasmic trafficking and nonsense-mediated decay (NMD) of mRNA. Cooperates with SKIP to synergistically activate E-box-mediated transcription through MYOD1 and may regulate the expression of muscle-specific genes. Binds to poly(A) and to poly(G) with high affinity. May protect the poly(A) tail from degradation. Subunit of the trimeric poly(A) tail exosome targeting (PAXT) complex, a complex that directs a subset of long and polyadenylated poly(A) RNAs for exosomal degradation. The RNA exosome is fundamental for the degradation of RNA in eukaryotic nuclei. Substrate targeting is facilitated by its cofactor MTREX, which links to RNA-binding protein adapters.
- Molecular Weight
- 31kDa/33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC0730
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat