Antibodies
Anti-PAK2 Antibody-Oligo Conjugate
SKU: aoc2998
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAK2 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase PAK 2
- UniProt Number
- Q13177
- Target Description
- Serine/threonine protein kinase that plays a role in a variety of different signaling pathways including cytoskeleton regulation, cell motility, cell cycle progression, apoptosis or proliferation. Acts as a downstream effector of the small GTPases CDC42 and RAC1. Activation by the binding of active CDC42 and RAC1 results in a conformational change and a subsequent autophosphorylation on several serine and/or threonine residues. Full-length PAK2 stimulates cell survival and cell growth. Phosphorylates MAPK4 and MAPK6 and activates the downstream target MAPKAPK5, a regulator of F-actin polymerization and cell migration. Phosphorylates JUN and plays an important role in EGF-induced cell proliferation. Phosphorylates many other substrates including histone H4 to promote assembly of H3.3 and H4 into nucleosomes, BAD, ribosomal protein S6, or MBP. Phosphorylates CASP7, thereby preventing its activity. Additionally, associates with ARHGEF7 and GIT1 to perform kinase-independent functions such as spindle orientation control during mitosis. On the other hand, apoptotic stimuli such as DNA damage lead to caspase-mediated cleavage of PAK2, generating PAK-2p34, an active p34 fragment that translocates to the nucleus and promotes cellular apoptosis involving the JNK signaling pathway. Caspase-activated PAK2 phosphorylates MKNK1 and reduces cellular translation.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1030
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat