Antibodies
Anti-PAK3 Antibody-Oligo Conjugate
SKU: aoc2999
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAK3 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase PAK 3
- UniProt Number
- O75914
- Target Description
- Serine/threonine protein kinase that plays a role in a variety of different signaling pathways including cytoskeleton regulation, cell migration, or cell cycle regulation. Plays a role in dendrite spine morphogenesis as well as synapse formation and plasticity. Acts as a downstream effector of the small GTPases CDC42 and RAC1. Activation by the binding of active CDC42 and RAC1 results in a conformational change and a subsequent autophosphorylation on several serine and/or threonine residues. Phosphorylates MAPK4 and MAPK6 and activates the downstream target MAPKAPK5, a regulator of F-actin polymerization and cell migration. Additionally, phosphorylates TNNI3/troponin I to modulate calcium sensitivity and relaxation kinetics of thin myofilaments. May also be involved in early neuronal development. In hippocampal neurons, necessary for the formation of dendritic spines and excitatory synapses; this function is dependent on kinase activity and may be exerted by the regulation of actomyosin contractility through the phosphorylation of myosin II regulatory light chain (MLC).
- Molecular Weight
- 62 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1955
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat