Antibodies
Anti-pan 14-3-3 Antibody-Oligo Conjugate
SKU: aoc3001
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-pan 14-3-3 Antibody-IF1
Antibody Target
- Target
- 14-3-3 protein theta
- Additional Target Information
- This antibody also binds 14-3-3 protein beta/alpha, Uniprot:P31946. This antibody also binds 14-3-3 protein gamma, Uniprot:P61981. This antibody also binds 14-3-3 protein epsilon, Uniprot:P62258. This antibody also binds 14-3-3 protein zeta/delta, Uniprot:P63104. This antibody also binds 14-3-3 protein eta, Uniprot:Q04917. This antibody also binds 14-3-3 protein sigma, Uniprot:P31947.
- UniProt Number
- P27348
- Target Description
- Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Negatively regulates the kinase activity of PDPK1.
- Molecular Weight
- 27kDa/28KDa/29KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC59297
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat