Antibodies
Anti-Pan Cadherin Antibody-Oligo Conjugate
SKU: aoc3002
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Pan Cadherin Antibody-IF1
Antibody Target
- Target
- Cadherin-1
- UniProt Number
- P12830
- Additional Target Information
- This antibody also binds Cadherin-2, Uniprot:P19022. This antibody also binds Cadherin-3, Uniprot:P22223. This antibody also binds Cadherin-5, Uniprot:P33151. This antibody also binds Cadherin-4, Uniprot:P55283. This antibody also binds Cadherin-4, Uniprot:P39038.
- Target Description
- Cadherins are calcium-dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. CDH1 is involved in mechanisms regulating cell-cell adhesions, mobility and proliferation of epithelial cells. Promotes organization of radial actin fiber structure and cellular response to contractile forces, via its interaction with AMOTL2 which facilitates anchoring of radial actin fibers to CDH1 junction complexes at the cell membrane. Plays a role in the early stages of desmosome cell-cell junction formation via facilitating the recruitment of DSG2 and DSP to desmosome plaques. Has a potent invasive suppressor role. It is a ligand for integrin alpha-E/beta-7.; FUNCTION: E-Cad/CTF2 promotes non-amyloidogenic degradation of Abeta precursors. Has a strong inhibitory effect on APP C99 and C83 production.; FUNCTION: (Microbial infection) Serves as a receptor for Listeria monocytogenes; internalin A (InlA) binds to this protein and promotes uptake of the bacteria.
- Molecular Weight
- 140 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1135
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse