Antibodies
Anti-PAR2 Antibody-Oligo Conjugate
SKU: aoc3004
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAR2 Antibody-IF1
Antibody Target
- Target
- Proteinase-activated receptor 2
- UniProt Number
- P55085
- Target Description
- Receptor for trypsin and trypsin-like enzymes coupled to G proteins. Its function is mediated through the activation of several signaling pathways including phospholipase C (PLC), intracellular calcium, mitogen-activated protein kinase (MAPK), I-kappaB kinase/NF-kappaB and Rho. Can also be transactivated by cleaved F2R/PAR1. Involved in modulation of inflammatory responses and regulation of innate and adaptive immunity, and acts as a sensor for proteolytic enzymes generated during infection. Generally is promoting inflammation. Can signal synergistically with TLR4 and probably TLR2 in inflammatory responses and modulates TLR3 signaling. Has a protective role in establishing the endothelial barrier; the activity involves coagulation factor X. Regulates endothelial cell barrier integrity during neutrophil extravasation, probably following proteolytic cleavage by PRTN3. Proposed to have a bronchoprotective role in airway epithelium, but also shown to compromise the airway epithelial barrier by interrupting E-cadherin adhesion. Involved in the regulation of vascular tone; activation results in hypotension presumably mediated by vasodilation. Associates with a subset of G proteins alpha subunits such as GNAQ, GNA11, GNA14, GNA12 and GNA13, but probably not with G(o)-alpha, G(i) subunit alpha-1 and G(i) subunit alpha-2. However, according to PubMed:21627585 can signal through G(i) subunit alpha. Believed to be a class B receptor which internalizes as a complex with arrestin and traffic with it to endosomal vesicles, presumably as desensitized receptor, for extended periods of time. Mediates inhibition of TNF-alpha stimulated JNK phosphorylation via coupling to GNAQ and GNA11; the function involves dissociation of RIPK1 and TRADD from TNFR1. Mediates phosphorylation of nuclear factor NF-kappa-B RELA subunit at 'Ser-536'; the function involves IKBKB and is predominantly independent of G proteins. Involved in cellular migration. Involved in cytoskeletal rearrangement and chemotaxis through beta-arrestin-promoted scaffolds; the function is independent of GNAQ and GNA11 and involves promotion of cofilin dephosphorylation and actin filament severing. Induces redistribution of COPS5 from the plasma membrane to the cytosol and activation of the JNK cascade is mediated by COPS5. Involved in the recruitment of leukocytes to the sites of inflammation and is the major PAR receptor capable of modulating eosinophil function such as pro-inflammatory cytokine secretion, superoxide production and degranulation. During inflammation promotes dendritic cell maturation, trafficking to the lymph nodes and subsequent T-cell activation. Involved in antimicrobial response of innate immune cells; activation enhances phagocytosis of Gram-positive and killing of Gram-negative bacteria. Acts synergistically with interferon-gamma in enhancing antiviral responses. Implicated in a number of acute and chronic inflammatory diseases such as of the joints, lungs, brain, gastrointestinal tract, periodontium, skin, and vascular systems, and in autoimmune disorders. Probably mediates activation of pro-inflammatory and pro-fibrotic responses in fibroblasts, triggered by coagulation factor Xa (F10). Mediates activation of barrier protective signaling responses in endothelial cells, triggered by coagulation factor Xa (F10).
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1246
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat