Antibodies
Anti-PAWR Antibody-Oligo Conjugate
SKU: aoc3015
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAWR Antibody-IF1
Antibody Target
- Target
- PRKC apoptosis WT1 regulator protein
- UniProt Number
- Q96IZ0
- Target Description
- Pro-apoptotic protein capable of selectively inducing apoptosis in cancer cells, sensitizing the cells to diverse apoptotic stimuli and causing regression of tumors in animal models. Induces apoptosis in certain cancer cells by activation of the Fas prodeath pathway and coparallel inhibition of NF-kappa-B transcriptional activity. Inhibits the transcriptional activation and augments the transcriptional repression mediated by WT1. Down-regulates the anti-apoptotic protein BCL2 via its interaction with WT1. Also seems to be a transcriptional repressor by itself. May be directly involved in regulating the amyloid precursor protein (APP) cleavage activity of BACE1.
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1980
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse