Antibodies
Anti-PAX5 Antibody-Oligo Conjugate
SKU: aoc3016
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAX5 Antibody-IF1
Antibody Target
- Target
- Paired box protein Pax-5
- UniProt Number
- Q02548
- Target Description
- Transcription factor that plays an essential role in commitment of lymphoid progenitors to the B-lymphocyte lineage. Fulfills a dual role by repressing B-lineage inappropriate genes and simultaneously activating B-lineage-specific genes. In turn, regulates cell adhesion and migration, induces V(H)-to-D(H)J(H) recombination, facilitates pre-B-cell receptor signaling and promotes development to the mature B-cell stage. Repression of the cohesin-release factor WAPL causes global changes of the chromosomal architecture in pro-B cells to facilitate the generation of a diverse antibody repertoire.; FUNCTION: (Microbial infection) Plays an essential role in the maintenance of Epstein-Barr virus genome copy number within the host cell by promoting EBNA1/oriP-dependent binding and transcription. Also participates in the inhibition of lytic EBV reactivation by modulating viral BZLF1 activity.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC1654
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human