Antibodies
Anti-PAX6 Antibody-Oligo Conjugate
SKU: aoc3017
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PAX6 Antibody-IF1
Antibody Target
- Target
- Paired box protein Pax-6
- UniProt Number
- P26367
- Target Description
- Transcription factor with important functions in the development of the eye, nose, central nervous system and pancreas. Required for the differentiation of pancreatic islet alpha cells. Competes with PAX4 in binding to a common element in the glucagon, insulin and somatostatin promoters. Regulates specification of the ventral neuron subtypes by establishing the correct progenitor domains. Acts as a transcriptional repressor of NFATC1-mediated gene expression.
- Molecular Weight
- 47kDa/48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC63795
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat