Antibodies
Anti-PBEF/Visfatin/NAMPT Antibody-Oligo Conjugate
SKU: aoc3021
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PBEF/Visfatin/NAMPT Antibody-IF1
Antibody Target
- Target
- Nicotinamide phosphoribosyltransferase
- UniProt Number
- P43490
- Target Description
- Catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. It is the rate limiting component in the mammalian NAD biosynthesis pathway. The secreted form behaves both as a cytokine with immunomodulating properties and an adipokine with anti-diabetic properties, it has no enzymatic activity, partly because of lack of activation by ATP, which has a low level in extracellular space and plasma. Plays a role in the modulation of circadian clock function. NAMPT-dependent oscillatory production of NAD regulates oscillation of clock target gene expression by releasing the core clock component: CLOCK-BMAL1 heterodimer from NAD-dependent SIRT1-mediated suppression.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53731
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat