Antibodies
Anti-PCAF Antibody-Oligo Conjugate
SKU: aoc3025
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PCAF Antibody-IF1
Antibody Target
- Target
- Histone acetyltransferase KAT2B
- UniProt Number
- Q92831
- Target Description
- Functions as a histone acetyltransferase (HAT) to promote transcriptional activation. Has significant histone acetyltransferase activity with core histones (H3 and H4), and also with nucleosome core particles. Has a a strong preference for acetylation of H3 at 'Lys-9' (H3K9ac). Also acetylates non-histone proteins, such as ACLY, MAPRE1/EB1, PLK4, RRP9/U3-55K and TBX5. Inhibits cell-cycle progression and counteracts the mitogenic activity of the adenoviral oncoprotein E1A. Acts as a circadian transcriptional coactivator which enhances the activity of the circadian transcriptional activators: NPAS2-BMAL1 and CLOCK-BMAL1 heterodimers. Involved in heart and limb development by mediating acetylation of TBX5, acetylation regulating nucleocytoplasmic shuttling of TBX5. Acts as a negative regulator of centrosome amplification by mediating acetylation of PLK4. Acetylates RRP9/U3-55K, a core subunit of the U3 snoRNP complex, impairing pre-rRNA processing. Acetylates MAPRE1/EB1, promoting dynamic kinetochore-microtubule interactions in early mitosis. Also acetylates spermidine.; FUNCTION: (Microbial infection) In case of HIV-1 infection, it is recruited by the viral protein Tat. Regulates Tat's transactivating activity and may help inducing chromatin remodeling of proviral genes.
- Molecular Weight
- 93 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC55963
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat